��վ��ͼ ԭ��������,���Ǿ���,����,ҽѧ,����,������800��רҵ,�ṩ60��ƪ����������Ѳο�
��Ҫ�������ķ���������޸ķ��񣬸���רҵ�У����á����ɡ���������������ľ�������Ӣ�����������������ͨѶ����ᡢ��ѧ��ũҵ����ҵ

������ɳ���Ͼ��ĵķ����ҩ������

��Դ��ԭ�������� ���ʱ�䣺2019-10-10

����ժ    Ҫ�������о��ɼ���ij�������Ƹ�Ⱦ�������IJ�������֯��������ɳ���Ͼ��ķ��롢�������Լ���10�ֳ��������ص�ҩ����������顣�����ʾ���������Ϊ������ɳ���Ͼ����԰��׿��ǣ�0%�������ù�أ�0%����ͷ����뿣�3.70%������ҩ�ʽϵͣ�����ù�أ�88.89%�����Ļ��أ�62.96%������Ī���֣�51.85%������ҩ�ʽϸߣ��ҷ��������ٿɶ�1��ҩ�������ҩ�ԣ�����ɶ�5��ҩ�������ҩ�ԣ�70.37%�ľ������3������ҩ�������3��ҩ��ľ���������ࣨ48.15%�������о�����ɶ��ٴ�������ҩ�ṩָ����ҲΪ�õ�������������ҩ�Լ���ṩ���ݡ�

�����ؼ��ʣ���������ɳ���Ͼ�; ����; ����; ��ҩ��;

����Abstract����The isolates of Salmonella Pullorum were isolated and identified from the suspect samples of the illness or dead chickens in a chicken farm, and their antimicrobial resistances to 10 common antibiotics were analysed by drug sensitivity test. The results showed that all the isolates were Salmonella Pullorum. The rates of antimicrobial resistance to amikacin (0%), gentamicin (0%) and cefotaxime (3.70%) were lower, yet the ones to streptomycin (88.89%), tetracycline (62.96%) and amoxicillin (51.85%) were higher. The Salmonella Pullorum isolates were resistant to 1 antibiotic at least, and 5 antibiotics at most. 70.37% isolates were resistant to 3 or more antibiotics, and the proportion of isolates resistant to 3 antibiotics was the highest (48.15%). The results of this study can provide guidance for rational drug use in clinic and a basis for monitoring the resistance of Salmonella Pullorum in this area.

����Keyword����Salmonella Pullorum; isolation; identification; antimicrobial resistance;

����������ɳ���Ͼ���Salmonella Pullorum��Ϊ���˾���ɳ���Ͼ����Ա����һ���ڼ����н�Ϊ��������Ҫ��ԭ��[1,2]����������������������԰�Ѫ֢�ȣ������ʽϸߣ����꼦����Ҫ�������Ը�Ⱦ�����θ�Ⱦ���ɳ��ڴ����Ҿ��Ѵ�ֱ�����������������˾޴�ľ�����ʧ[3,4,5]��Ŀǰʹ�ÿ����ؽ����������Ƿ��μ���������Ҫ��ʩ֮һ�������ڿ����صij���ʹ�������Dz�����ʹ�ã�ʹ��ɳ���Ͼ������˹㷺�����ص���ҩ��[6,7,8,9]����˼�ǿ�����в�ԭ������ҩ�Լ�����ϸ�����ķ���������Ҫ��

�������о��ɼ�ij�������Ƹ�Ⱦ�������IJ�������֯������ɳ���Ͼ��ķ��롢������ҩ����������飬����ҩ����������Ϊ�ü���������ҩ�ṩָ����ҲΪ�õ������������ۺϷ��ؼ���ҩ�Լ���ṩ���ݡ�

����1 �������뷽��

����1.1 ����Ʒ�ɼ�

����ѡȡij�����ٴ�֢״�벡��仯���Ƽ������IJ�����32 ֻ���ɼ��������ĸ������������֯��Ϊ���첡�ϡ�
 

������ɳ���Ͼ��ĵķ����ҩ������
 

����1.2�� �Լ�

�����󿵿���֬��LB��������������Ⱦɫ�Լ��еȹ����ൺ�������\�����޹�˾��ϸ��΢��������Ӧ�ܣ������ǡ����ǡ����ǡ���ѿ�ǡ��������ǡ������ǡ���¶������ì�������ᡢ���⡢�������Σ���ҩ��ֽƬ����Ī���֡���ŵɳ�ǡ�����ɳ�ǡ����ù�ء����׿��ǡ���ù�ء�ͷ����뿡�ͷ�����֡�ǿ��ù�ء��Ļ��أ����Ժ������΢�����Լ����޹�˾��DL2000 DNA Marker��2×Taq PCR Master Mix���Ա����﹤�̣����������޹�˾��

����1.3�� ϸ���ķ�������

�����޾��ɼ��������ĸ��ࡢ�������֯��Ʒ�������󿵿���֬ƽ���ϣ�37 ������18~24 h��ѡȡ�������ɾ��䰴������ƽ�巴�����߻�ô���������ȡ���ʹ�������������LB����������ҡ�����������������ں���������

����1.4 ���������Ⱦɫ����

������ȡ�������Ŀ��ɾ����Ƴ�ͿƬ�����ո�����Ⱦɫ�Լ���˵�������Ⱦɫ�����죬�۲������̬��

����1.5 �����������������

��������ϸ��΢��������Ӧ��˵���飬������������ֱ���������������У���37 ������24~48 h�۲�����

����1.6 ��������ɳ���Ͼ���PCR����

�������ݲο�����[10]���ϳɼ�����ɳ���Ͼ���Ѫ����������PCR�������������5’- CGATAATGGCAACCGCACTG -3’���������5’- TGATGTCTGCCCCTTTCGAC -3’�����������СΪ356bp���������������﹤�̣��Ϻ����ɷ����޹�˾�ϳɡ�

����ȡ200 μL�����Һ��������ѽⷨ��ȡ������DNA���Դ�Ϊģ�����PCR������ͬʱ�����ȥ����ˮΪ���Զ��ա�PCR��Ӧ��ϵΪ25 μL�����и����Ϊ��ģ��1 μL��2×Taq PCR Master Mix 12.5 μL�����������10 μmol/L����0.5 μL�������ȥ����ˮ������25 μL��PCR��Ӧ����Ϊ��94 ��Ԥ����5 min��94 �����30 s��55 ���˻�30 s��72 ������30 s��30��ѭ����72 ������7 min������1%����֬��������Ӿ������ж�������Ѫ���͡�

����1.7 ���������ҩ������

�����Դ󳦰�ϣ�Ͼ�ATCC25922Ϊҩ���ʿؾ��꣬����K-BֽƬ��ɢ�����з������ҩ������[11]����������24 h��������Һ���޾�������ˮ���ó�0.5���ϵ�λ������Ϳ����LB��֬ƽ���ϣ�����ҩ��ֽƬ����37 ������18~24 h�������־�Ȧֱ�����ж��������10�ֳ��ÿ����ص���ҩ���[12]��

����2 �����������

����2.1�� ����ij��������뾵��

������������֯�з���Ŀ��ɾ������󿵿���֬ƽ�����γ�Բ�Ρ��⻬����ɫ����ɫ��ϸС���䣬�����䷴�����������������27����ɾ����������������Ⱦɫ�����Ϊ��С����ͷ��Բ�ĸ��������Ը˾�����Ϊ��ɢ���ڣ�����ɳ���Ͼ��ľ���������

����2.2�� ��������

������27�괿�����Ŀ��ɾ��������΢��������Ӧ���У�37 ������24~48 h�󣬷����������������һ�£���1�������ܷ��������ǡ��������ǡ������ǡ���¶������ì�������������ǡ����ǡ���ѿ�ǣ����������ᡢ���⣬�������������Σ����ϼ�����ɳ���Ͼ����������ԡ�

������1���������������
��1���������������

����ע��+��ʾ��ӦΪ���ԣ�-��ʾ��ӦΪ����“+” indicates positive reaction; “-” indicates negative reaction

����2.3�� ����Ѫ���͵�PCR����

�����ü�����ɳ���Ͼ��������������PCR��⣬27����ɾ������������356 bp��Ŀ��������ͼ1����֤���������õľ����Ϊ������ɳ���Ͼ���

����ͼ1���ַ�����PCR�������
ͼ1���ַ�����PCR�������

����Fig.1 Identification results of partial isolates by PCR

����M��DNA ��������׼��1�����Զ��գ�2-9�����ַ������M: DL2000 DNA Marker; 1: Negative control; 2-9: Some isolates

����2.4�� ҩ������

������27 �꼦����ɳ���Ͼ������������10 �ֳ��ÿ����ص���������飬�����ʾ����������˶԰��׿��Ǻ����ù�ص�����ʴ�100%���⣬��������8 ��ҩ����в�ͬ�̶ȵ���ҩ�������ҩ���ɸߵ��ͷֱ�Ϊ����ù�أ�88.89%�����Ļ��أ�62.96%������Ī���֣�51.85%����ǿ��ù�أ�37.04%����ͷ�����֣�29.63%������ŵɳ�ǣ�14.81%��������ɳ�ǣ�7.41%����ͷ����뿣�3.70%������2����

������2������ɳ���Ͼ��������ҩ��������
��2������ɳ���Ͼ��������ҩ��������

����ɳ���Ͼ�������Ķ�����ҩ���Ҳʮ�����أ����з��������ٿ���һ��ҩ�70.37%��19/27���ľ��������������ҩ��������;���������࣬��48.15%��13/27������7.41%��2/27���ľ�������������ҩ�ͼ2������Щ���صĶ�����ҩ�������ɼ��������Ѷȵ�����

����ͼ2������ɳ���Ͼ�������Ķ�����ҩ���
ͼ2������ɳ���Ͼ�������Ķ�����ҩ���

����Fig.2 Multi-drug resistance of Salmonella Pullorum isolates

�������ݱ��о��е�ҩ��������������ü���ѡȡ���׿��ǡ����ù�ء�ͷ����뿵ȸ���ҩ����м������ķ��ι������������ƹ����в��ý�����ҩ���ֻ���ҩ�ȷ�ʽ���Դﵽ�Ϻõ���Ч��������ҩ��������Ŀ�����[13]��ͬʱ����ǿ��������������ˮƽ���������ﰲȫ��ϵ�����ڶԻ�������е�Ƚ����������Ӷ������²�������ֳ�봫������֤��Ⱥ�Ľ�����ֳ��

���������

����[1] ������, ������, ���°�, ��. ������ɳ���Ͼ��о���չ[J]. �й�����, 2014, 36(5): 34-37.
����[2] ������. ���Ʒ��ɳ���Ͼ���Ⱦ�ļ�������[J]. �Ĵ�������ҽ, 2003, 30(4): 28-29.
����[3] ����, ������, ���ٻ�, ��. ɳ���Ͼ��ļ�⼼����չ[J]. �й����ﴫȾ��ѧ��, 2012, 20(2): 81-86.
����[4] �����, ������, ����, ��. ������ҩ���²���ɳ���Ͼ�I�������ӵļ�⼼��[J]. �й�������ҽ, 2012, 1: 172-177.
����[5] ���ij�. ����ij����������ɳ���Ͼ��ķ����������ҩ���ӻ����о�[J]. �ִ�������ҽ, 2017, 4: 34-40.
����[6] ������, ������. ɳ���Ͼ����²��Ժ���ҩ���о���չ[J]. �����г�, 2008, 4: 43-46.
����[7] ��־��, ���°�, ��ѧ��, ��. ������ɳ���Ͼ���ҩ�Եı仯����[J]. �й�Ԥ����ҽѧ��, 1999, 21(4): 305-307.
����[8] Ji H K, Jong H P, Lee Y J, et al. Molecular and virulence characteristics of multi-drug resistant Salmonella Enteritis’s strains isolated from poultry[J]. Vet. J, 2011, 189(3): 306-311.
����[9] Zhao S, Mcdermott P F, White D G. Characterization of multidrug resistant Salmonella recovered from diseased animals[J]. Veterinary Microbiology, 2007, 23: 122-132.
����[10] ��ͯ��, ������, �ܿ�, ��. ������ɳ���Ͼ��������²���ɳ���Ͼ���Ѫ����������PCR�����ⷽ���Ľ���[J]. �й�Ԥ����ҽѧ��, 2017, 39(3): 215-219.
����[11] ����Ȫ, ���°�, ������, ��. ���ղ��ֵ���ʳԴ�Ժ���Դɳ���Ͼ��Ķ�����ҩ���о�[J]. ΢����ѧ��, 2007, 4, 47(2): 221-227.
����[12] ½��, ����, �Ժ���, ��. ��Դ����ɳ���Ͼ��Կ���ҩ�����ҩ�Է���[J]. �й����޹�����ѧ��, 2014, 1: 17-22.
����[13] ����ϼ, ������. ϸ����ҩ�Ի��Ƽ���ҩ�Կ��ƶԲ�[J]. ����ҽѧ��չ, 2001, 22(4): 4-7.

��Ҫ��ʾ��ת�ر�վ��Ϣ��ע����Դ��ԭ��������������Ȩ�������������վ������
�Ķ���ʾ���������ж���Ϣ����ʵ�Լ��۵�����󣬱�վ�Ų�����